DNA chain: AGCTATCTAGCTAGCATGCTAGCTAGCAGTCAGTAGCTAGGATCGTAGCC
DNA Transcription: TCGATAGATCGATCGTACGATCGATCGTCAGTCATCGATCCTAGCATCGG
Monday, March 15, 2010
Thursday, March 4, 2010
Friday, February 26, 2010
Reflection on Debate
My debate was against Jonathan George who raised the point that genes are what we are born with and coincide with God's plan for us. I said it didn't count for non-christians then and people are raised to think that.
3 Debate Issues
1st Debate Point:
John R. Watson conducted an experiment that showed that people develop phobias based on prior experiences and they aren't born with them by causing a previously unafraid baby to attain a fear of rats.
2nd Debate Point:
People who have genetic disorders can overcome them with treatments, proving that genetic disorders can be overcome
3rd Debate Point:
People who say genes determine how you act are just making excuses for criminals to feel better about how they are, it's an easy answer.
John R. Watson conducted an experiment that showed that people develop phobias based on prior experiences and they aren't born with them by causing a previously unafraid baby to attain a fear of rats.
2nd Debate Point:
People who have genetic disorders can overcome them with treatments, proving that genetic disorders can be overcome
3rd Debate Point:
People who say genes determine how you act are just making excuses for criminals to feel better about how they are, it's an easy answer.
Wednesday, February 24, 2010
Genetics Debate
Topic 5: Behavior can be traced to genetic makeup (Nature vs. Nurture)
Sources:
http://genealogy.about.com/cs/geneticgenealogy/a/nature_nurture_2.htm
Introduction to Psychology page 604
http://http://news.bbc.co.uk/2/hi/in_depth/sci_tech/2000/human_genome/760724.stm
Sources:
http://genealogy.about.com/cs/geneticgenealogy/a/nature_nurture_2.htm
Introduction to Psychology page 604
http://http://news.bbc.co.uk/2/hi/in_depth/sci_tech/2000/human_genome/760724.stm
Subscribe to:
Posts (Atom)